Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid(NM_001243.3)

Product Information

NCBI RefSeq: NM_001243.3

RefSeq ORF Size: 1788

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 8.

Gene Synonym: CD30,D1S166E,Ki-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD30/TNFRSF8 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid HG10777-UTLN pLV-untagged 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10777-CFLN pLV-C-FLAG 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10777-CHLN pLV-C-His 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10777-CMLN pLV-C-Myc 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10777-CYLN pLV-C-HA 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10777-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10777-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10777-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10777-NHLN pLV-SP-N-His 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10777-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD30/TNFRSF8 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10777-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily. CD30 protein is expressed by activated, but not resting, T and B cells. CD30 can regulate proliferation of lymphocytes and may also play an important role in human immunodeficiency virus replication. As a regulator of apoptosis, CD30 protein induces cell death or proliferation, depending on the cell type, and has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. CD30 protein expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs), and CD30 is also linked to leukocytes in patients with chronic inflammatory diseases, including lupus erythematosus, asthma, rheumatoid arthritis and atopic dermatitis (AD).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Rossi FM, et al. (2001) CD30L up-regulates CD30 and IL-4 expression by T cells. FEBS Lett. 508(3): 418-22.
  • Trovato M, et al. (2001) Expression of CD30 ligand and CD30 receptor in normal thyroid and benign and malignant thyroid nodules. Thyroid. 11(7): 621-8.
  • Ekstrom ES, et al. (2001) Presence of CD30(+) and CD30L(+) cells in human placenta and soluble CD30 levels in cord blood are independent of maternal atopy. Placenta. 22(4): 372-9.
  • Tang C, et al. (2008) A novel role of CD30L/CD30 signaling by T-T cell interaction in Th1 response against mycobacterial infection. J Immunol. 181(9): 6316-27.
  • Sun X, et al. (2008) A critical role of CD30 ligand/CD30 in controlling inflammatory bowel diseases in mice. Gastroenterology. 134(2): 447-58.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in Oncology and Autoimmune and Inflammatory Diseases.Adv Exp Med Biol. 647: 174-85.