Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid(NM_001252.3)

Product Information

NCBI RefSeq: NM_001252.3

RefSeq ORF Size: 582

cDNA Description: Full length Clone DNA of Homo sapiens CD70 molecule.

Gene Synonym: CD27L,CD27LG,TNFSF7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD70/CD27L/TNFSF7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid HG10780-UTLN pLV-untagged 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10780-CFLN pLV-C-FLAG 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10780-CHLN pLV-C-His 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10780-CMLN pLV-C-Myc 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10780-CYLN pLV-C-HA 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10780-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10780-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10780-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10780-NHLN pLV-SP-N-His 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10780-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD70/CD27L/TNFSF7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10780-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.