Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid(NM_000660.4)

Product Information

NCBI RefSeq: NM_000660.4

RefSeq ORF Size: 1173

cDNA Description: Full length Clone DNA of Homo sapiens transforming growth factor, beta 1.

Gene Synonym: CED,DPD1,LAP,TGF-beta 1,TGFB,TGFbeta

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TGF-beta 1/TGFB1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid HG10804-UTLN pLV-untagged 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10804-CFLN pLV-C-FLAG 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10804-CHLN pLV-C-His 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10804-CMLN pLV-C-Myc 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10804-CYLN pLV-C-HA 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10804-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10804-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10804-NFLN pLV-SP-N-Flag 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10804-NHLN pLV-SP-N-His 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10804-NMLN pLV-SP-N-Myc 2-3 weeks
Human TGF-beta 1/TGFB1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10804-NYLN pLV-SP-N-HA 2-3 weeks

Background

TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-

Reference

  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.