Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid(NM_002020.4)

Product Information

NCBI RefSeq: NM_002020.4

RefSeq ORF Size: 3897

cDNA Description: Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 4.

Gene Synonym: FLT-4,FLT-41,FLT41,LMPH1A,PCL,VEGFR-3,VEGFR3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VEGFR3/FLT-4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid HG10806-UTLN pLV-untagged 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10806-CFLN pLV-C-FLAG 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10806-CHLN pLV-C-His 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10806-CMLN pLV-C-Myc 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10806-CYLN pLV-C-HA 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10806-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10806-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10806-NFLN pLV-SP-N-Flag 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10806-NHLN pLV-SP-N-His 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10806-NMLN pLV-SP-N-Myc 2-3 weeks
Human VEGFR3/FLT-4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10806-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.