Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD21 Gene Lentiviral ORF cDNA expression plasmid(NM_001877.3)

Product Information

NCBI RefSeq: NM_001877.3

RefSeq ORF Size: 3102

cDNA Description: Full length Clone DNA of Homo sapiens complement component (3d/Epstein Barr virus) receptor 2.

Gene Synonym: C3DR,CD21,CR,CVID7,SLEB9

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD21 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD21 Gene Lentiviral ORF cDNA expression plasmid HG10811-UTLN pLV-untagged 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10811-CFLN pLV-C-FLAG 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10811-CHLN pLV-C-His 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10811-CMLN pLV-C-Myc 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10811-CYLN pLV-C-HA 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10811-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10811-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10811-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10811-NHLN pLV-SP-N-His 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10811-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD21 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10811-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD21, also known as Complement component (3d / Epstein Barr virus) receptor 2 and CR2, is a member of the CD system and is a protein involved in complement system. CD21 is present on all mature B-cells and some T-cells and follicular dendritic cells. CD21 on mature B-cells form a complex called the B cell receptor complex with two other membrane proteins, CD19 and CD81. CD21 has a function in the complement system through serving as the cellular receper specific for ligands such as C3 and C4 which can be attached to foreign macromolecules in order to remove or uptake them. This results in B-cells having enhanced response to the antigen.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joseph M, et al. (1989) Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21). Advanced in immunology. 46: 183-219.
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature 358: 505 - 7.