Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid(NM_001775.2)

Product Information

NCBI RefSeq: NM_001775.2

RefSeq ORF Size: 903

cDNA Description: Full length Clone DNA of Homo sapiens CD38 molecule.

Gene Synonym: ADPRC 1,ADPRC1,T10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD38/ADPRC1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid HG10818-UTLN pLV-untagged 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10818-CFLN pLV-C-FLAG 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10818-CHLN pLV-C-His 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10818-CMLN pLV-C-Myc 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10818-CYLN pLV-C-HA 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10818-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10818-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10818-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10818-NHLN pLV-SP-N-His 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10818-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD38/ADPRC1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10818-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 38 (CD38), also known as ADP-ribosyl cyclase, is a glycoprotein found on the surface of many immune cells (white blood cells), including CD4+, CD8+, B and natural killer cells. It shares several characteristics with ADP-ribosyl cyclase 2 CD157. CD38 is a multifunctional ectoenzyme that catalyzes the synthesis and hydrolysis of cyclic ADP-ribose (cADPR) from NAD+ to ADP-ribose. It also functions in cell adhesion, signal transduction and calcium signaling. CD38 has been used as a prognostic marker in leukemia. It can also be used to identify plasma cells.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.