Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid(NM_000141.4)

Product Information

NCBI RefSeq: NM_000141.4

RefSeq ORF Size: 2466

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 2.

Gene Synonym: BBDS,BEK,BFR-1,CD332,CEK3,CFD1,ECT1,JWS,K-SAM,KGFR,TK14,TK25

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGFR2/CD332 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid HG10824-UTLN pLV-untagged 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10824-CFLN pLV-C-FLAG 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10824-CHLN pLV-C-His 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10824-CMLN pLV-C-Myc 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10824-CYLN pLV-C-HA 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10824-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10824-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10824-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10824-NHLN pLV-SP-N-His 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10824-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGFR2/CD332 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10824-NYLN pLV-SP-N-HA 2-3 weeks

Background

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.