Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_001111097.1)

Product Information

NCBI RefSeq: NM_001111097.1

RefSeq ORF Size: 1476

cDNA Description: Full length Clone DNA of Homo sapiens v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2.

Gene Synonym: JTK8,p53Lyn,p56Lyn

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Lyn transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10829-UTLN pLV-untagged 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10829-CFLN pLV-C-FLAG 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10829-CHLN pLV-C-His 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10829-CMLN pLV-C-Myc 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10829-CYLN pLV-C-HA 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10829-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10829-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10829-NFLN pLV-SP-N-Flag 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10829-NHLN pLV-SP-N-His 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10829-NMLN pLV-SP-N-Myc 2-3 weeks
Human Lyn transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10829-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tyrosine-protein kinase Lyn is a member of the Src family of protein tyrosine kinases, which is mainly expressed in hematopoietic cells, in neural tissues liver, and adipose tissue. Tyrosine-protein kinase Lyn has many functions. Lyn kinase may down regulate expression of stem cell growth factor receptor (KIT). Lyn kinase Acts as an effector of EpoR (erythropoietin receptor) in controlling KIT expression and may play a central role in erythroid differentiation during the switch between proliferation and maturation. Lyn kinase also acts as a positive regulator of cell movement while negatively regulating adhesion to stromal cells by inhibiting the ICAM-1-binding activity of beta-2 integrins. Lyn kinase relays suppressing signals from the chemokine receptor CXCR4 to beta-2 integrin LFA-1 in hematopoietic precursors. This kinase is Involved in induction of stress-activated protein kinase (SAPK), but not ERK or p38 MAPK, in response to genotoxic agents. In a word, Lyn kinase functions primarily as negative regulator, but can also function as activator, depending on the context. Tyrosine-protein kinase Lyn Required for the initiation of the B-cell response, but also for its down-regulation and termination. It also Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. It has been reported that Lyn kinase plays a role in the inflammatory response to bacterial lipopolysaccharide. Lyn kinase Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils.

Reference

  • Grishin A V, et al. (2001) Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis. Proc Natl Acad Sci U.S.A. 98 (18): 10172-7.
  • Hayashi T, et al. (1999) The AMPA receptor interacts with and signals through the protein tyrosine kinase Lyn. Nature. 397(6714): 72-6.
  • Ptasznik A, et al. (2004) Short interfering RNA (siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+) leukemia cells. Nat Med. 10(11): 1187-9.