Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid(NM_001065.2)

Product Information

NCBI RefSeq: NM_001065.2

RefSeq ORF Size: 1368

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 1A.

Gene Synonym: CD120a,FPF,MS5,p55,p55-R,p60,TBP1,TNF-R,TNF-R-I,TNF-R55,TNFAR,TNFR1,TNFR1-d2,TNFR55,TNFR60

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TNFR1/TNFRSF1A/CD120a Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid HG10872-UTLN pLV-untagged 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10872-CFLN pLV-C-FLAG 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10872-CHLN pLV-C-His 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10872-CMLN pLV-C-Myc 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10872-CYLN pLV-C-HA 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10872-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10872-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10872-NFLN pLV-SP-N-Flag 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10872-NHLN pLV-SP-N-His 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10872-NMLN pLV-SP-N-Myc 2-3 weeks
Human TNFR1/TNFRSF1A/CD120a Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10872-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD120a (cluste of differentiation 120a), also known as TNFR1 / TNFRSF1A, is a member of CD family, tumor necrosis factor receptor superfamily. CD120a is one of the most primary receptors for the tumor necrosis factor-alpha. It has been shown to be localized to both plasma membrane lipid rafts and the trans golgi complex with the help of the death domain (DD). CD120a can activate the transcription factor NF-κB, mediate apoptosis, and regulate inflammation processes.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Cottin V, et al. (2002) Restricted localization of the TNF receptor CD120a to lipid rafts: a novel role for the death domain. The journal of immunology. 168: 4095-102.