Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid(NM_002526.2)

Product Information

NCBI RefSeq: NM_002526.2

RefSeq ORF Size: 1725

cDNA Description: Full length Clone DNA of Homo sapiens 5'-nucleotidase, ecto (CD73).

Gene Synonym: CALJA,CD73,E5NT,eN,eNT,NT,NT5,NTE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD73/NT5E Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid HG10904-UTLN pLV-untagged 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10904-CFLN pLV-C-FLAG 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10904-CHLN pLV-C-His 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10904-CMLN pLV-C-Myc 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10904-CYLN pLV-C-HA 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10904-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10904-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10904-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10904-NHLN pLV-SP-N-His 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10904-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD73/NT5E Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10904-NYLN pLV-SP-N-HA 2-3 weeks

Background

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

Reference

  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Gr