Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF21 Gene Lentiviral ORF cDNA expression plasmid(NM_019113.2)

Product Information

NCBI RefSeq: NM_019113.2

RefSeq ORF Size: 630

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 21.

Gene Synonym: UNQ3115 / PRO10196

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF21 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid HG10911-UTLN pLV-untagged 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10911-CFLN pLV-C-FLAG 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10911-CHLN pLV-C-His 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10911-CMLN pLV-C-Myc 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10911-CYLN pLV-C-HA 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10911-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10911-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10911-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10911-NHLN pLV-SP-N-His 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10911-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF21 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10911-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

Reference

  • Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.
  • Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.
  • Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.