Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_002659.2)

Product Information

NCBI RefSeq: NM_002659.2

RefSeq ORF Size: 1008

cDNA Description: Full length Clone DNA of Homo sapiens plasminogen activator, urokinase receptor , transcript variant 1.

Gene Synonym: CD87,U-PAR,UPAR,URKR

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PLAUR/CD87 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10925-UTLN pLV-untagged 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10925-CFLN pLV-C-FLAG 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10925-CHLN pLV-C-His 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10925-CMLN pLV-C-Myc 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10925-CYLN pLV-C-HA 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10925-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10925-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10925-NFLN pLV-SP-N-Flag 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10925-NHLN pLV-SP-N-His 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10925-NMLN pLV-SP-N-Myc 2-3 weeks
Human PLAUR/CD87 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10925-NYLN pLV-SP-N-HA 2-3 weeks

Background

Urokinase plasminogen activator (uPA) and/or its receptor (uPAR) are essential for metastasis, and overexpression of these molecules is strongly correlated with poor prognosis in a variety of malignant tumours. uPAR and uPA levels in both resected tumor tissue and plasma are of independent prognostic significance for patient survival in several types of human cancer. This system has classically been thought to drive tumor progression by mediating directed extracellular proteolysis on the surface of migrating or invading cells, and intervening with this proteolysis by targeting uPAR has been proposed to represent a novel approach for inhibiting tumor progression. uPAR, also known as PLAUR or CD87, has been implicated in the growth, metastasis, and angiogenesis of several solid and hemotologic malignancies. uPAR is a highly glycosylated, 55-60kDa integral membrane protein linked to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchor. It is part of a cell surface system that also consists of the serine protease uPA and several specific inhibitors (plasminogen activator inhibitors 1 and 2). Additionally, the analysis of CD87 (urokinase-type plasminogen activator receptor - uPAR) expression has a potential role in the diagnostic or prognostic work-up of several hematological malignancies, particularly acute leukemia and multiple myeloma.

Reference

  • Romer J, et al. (2004) The urokinase receptor as a potential target in cancer therapy. Curr Pharm Des. 10(19): 2359-76.
  • Bn MC, et al. (2004) CD87 (urokinase-type plasminogen activator receptor), function and pathology in hematological disorders: a review. Leukemia. 18(3): 394-400.
  • Pillay V, et al. (2007) The urokinase plasminogen activator receptor as a gene therapy target for cancer. Trends Biotechnol. 25(1): 33-9.
  • Mazar AP. (2008) Urokinase plasminogen activator receptor choreographs multiple ligand interactions: implications for tumor progression and therapy. Clin Cancer Res. 14(18): 5649-55.