Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid(NM_000572.2)

Product Information

NCBI RefSeq: NM_000572.2

RefSeq ORF Size: 537

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 10.

Gene Synonym: CSIF,GVHDS,IL-10,IL10A,Interleukin-10,TGIF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL10/IL-10/Interleukin-10 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid HG10947-UTLN pLV-untagged 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10947-CFLN pLV-C-FLAG 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10947-CHLN pLV-C-His 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10947-CMLN pLV-C-Myc 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10947-CYLN pLV-C-HA 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10947-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10947-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10947-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10947-NHLN pLV-SP-N-His 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10947-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL10/IL-10/Interleukin-10 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10947-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.