Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid(NM_000211.3)

Product Information

NCBI RefSeq: NM_000211.3

RefSeq ORF Size: 2310

cDNA Description: Full length Clone DNA of Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit).

Gene Synonym: CD18,LAD,LCAMB,LFA-1,MAC-1,MF17,MFI7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD18/Integrin beta 2/ITGB2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid HG10970-UTLN pLV-untagged 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10970-CFLN pLV-C-FLAG 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10970-CHLN pLV-C-His 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10970-CMLN pLV-C-Myc 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10970-CYLN pLV-C-HA 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10970-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10970-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10970-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10970-NHLN pLV-SP-N-His 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10970-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD18/Integrin beta 2/ITGB2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10970-NYLN pLV-SP-N-HA 2-3 weeks

Background

Integrins form a family of heterodimeric transmembrane receptors that regulate cell

Reference

  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.