Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid(NM_000733.3)

Product Information

NCBI RefSeq: NM_000733.3

RefSeq ORF Size: 624

cDNA Description: Full length Clone DNA of Homo sapiens CD3e molecule, epsilon (CD3-TCR complex).

Gene Synonym: CD3 epsilon,IMD18,T3E,TCRE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD3e/CD3 epsilon Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid HG10977-UTLN pLV-untagged 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10977-CFLN pLV-C-FLAG 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10977-CHLN pLV-C-His 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10977-CMLN pLV-C-Myc 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10977-CYLN pLV-C-HA 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10977-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10977-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10977-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10977-NHLN pLV-SP-N-His 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10977-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD3e/CD3 epsilon Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10977-NYLN pLV-SP-N-HA 2-3 weeks

Background

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.