Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid(NM_001768.5)

Product Information

NCBI RefSeq: NM_001768.5

RefSeq ORF Size: 708

cDNA Description: Full length Clone DNA of Homo sapiens CD8a molecule.

Gene Synonym: CD8,CD8 alpha,Leu-2,Leu2,MAL,p32,p32 186910

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD8/CD8 alpha/Leu-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid HG10980-UTLN pLV-untagged 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10980-CFLN pLV-C-FLAG 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10980-CHLN pLV-C-His 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10980-CMLN pLV-C-Myc 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10980-CYLN pLV-C-HA 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10980-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10980-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10980-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10980-NHLN pLV-SP-N-His 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10980-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD8/CD8 alpha/Leu-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10980-NYLN pLV-SP-N-HA 2-3 weeks

Background

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

Reference

    References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.