Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid(NM_000732.4)

Product Information

NCBI RefSeq: NM_000732.4

RefSeq ORF Size: 516

cDNA Description: Full length Clone DNA of Homo sapiens CD3d molecule, delta (CD3-TCR complex).

Gene Synonym: CD3 delta,CD3-DELTA,IMD19,T3D

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD3d/CD3 delta Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid HG10981-UTLN pLV-untagged 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10981-CFLN pLV-C-FLAG 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10981-CHLN pLV-C-His 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10981-CMLN pLV-C-Myc 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10981-CYLN pLV-C-HA 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10981-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10981-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10981-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10981-NHLN pLV-SP-N-His 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10981-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD3d/CD3 delta Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10981-NYLN pLV-SP-N-HA 2-3 weeks

Background

T-cell surface glycoprotein CD3 delta chain, also known as CD3D, is a single-pass type I membrane protein. CD3D, together with CD3-gamma, CD3-epsilon and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The majority of T cell receptor (TCR) complexes in mice and humans consist of a heterodimer of polymorphic TCRalpha and beta chains along with invariant CD3gamma, delta, epsilon, and zeta chains. CD3 chains are present as CD3gammaepsilon, deltaepsilon, and zetazeta dimers in the receptor complex and play critical roles in the antigen receptor assembly, transport to the cell surface, and the receptor-mediated signal transduction. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. The T cell receptor-CD3 complex is unique in having ten cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs). CD3D contains 1 ITAM domain and has been shown to interact with CD8A. In the mouse, knockout of CD3delta allows some degree of T lymphocyte differentiation since mature CD4 and CD8 as well as TCRgammadelta T lymphocytes are observed in the periphery. In contrast, deleterious mutation of the CD3delta encoding gene in the human leads to a severe combined immunodeficiency characterised by the complete absence of mature T cell subpopulations including TCRalpha/beta and TCRgamma/delta. Defects in CD3D cause severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (T-/B+/NK+ SCID) which is a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. In humans the absence of CD3 delta results in a complete arrest in thymocyte development at the stage of double negative to double positive transition and the development of gamma delta T-cell receptor-positive T cells is also impaired.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Roifman CM. (2004) CD3 delta immunodeficiency. Curr Opin Allergy Clin Immunol. 4(6): 479-84.
  • Pan Q, et al. (2006) Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol. 43(11): 1741-50.
  • Le Deist F, et al. (2007) Expression anomalies of the CD3-TCR complex expression and immunodeficiencies. Med Sci (Paris). 23(2): 161-6.