Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD2 Gene Lentiviral ORF cDNA expression plasmid(NM_001767.3)

Product Information

NCBI RefSeq: NM_001767.3

RefSeq ORF Size: 1056

cDNA Description: Full length Clone DNA of Homo sapiens CD2 molecule.

Gene Synonym: LFA-2,SRBC,T11

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD2 Gene Lentiviral ORF cDNA expression plasmid HG10982-UTLN pLV-untagged 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10982-CFLN pLV-C-FLAG 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10982-CHLN pLV-C-His 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10982-CMLN pLV-C-Myc 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10982-CYLN pLV-C-HA 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10982-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10982-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10982-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10982-NHLN pLV-SP-N-His 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10982-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10982-NYLN pLV-SP-N-HA 2-3 weeks

Background

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.