Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid(NM_000062.2)

Product Information

NCBI RefSeq: NM_000062.2

RefSeq ORF Size: 1503

cDNA Description: Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), member 1.

Gene Synonym: C1IN,C1INH,C1NH,HAE1,HAE2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C1 inhibitor/SerpinG1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid HG10995-UTLN pLV-untagged 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10995-CFLN pLV-C-FLAG 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10995-CHLN pLV-C-His 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10995-CMLN pLV-C-Myc 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10995-CYLN pLV-C-HA 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10995-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10995-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10995-NFLN pLV-SP-N-Flag 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10995-NHLN pLV-SP-N-His 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10995-NMLN pLV-SP-N-Myc 2-3 weeks
Human C1 inhibitor/SerpinG1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10995-NYLN pLV-SP-N-HA 2-3 weeks

Background

Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN, is a serine proteinase inhibitor (serpin) that regulates activation of both the complement and contact systems. By its C-terminal part (serpin domain), characterized by three beta-sheets and an exposed mobile reactive loop, C1-INH binds, and blocks the activity of its target proteases. The N-terminal end (nonserpin domain) confers to C1-INH the capacity to bind lipopolysaccharides and E-selectin. Owing to this moiety, C1-INH intervenes in regulation of the inflammatory reaction. The heterozygous deficiency of C1-INH results in hereditary angioedema (HAE). Owing to its ability to modulate the contact and complement systems and the convincing safety profile, plasma-derived C1 inhibitor is an attractive therapeutic protein to treat inflammatory diseases other than HAE. Deficiency of C1 inhibitor results in hereditary angioedema, which is characterized by recurrent episodes of localized angioedema of the skin, gastrointestinal mucosa or upper respiratory mucosa. C1 inhibitor may prove useful in a variety of other diseases including septic shock, reperfusion injury, hyperacute transplant rejection, traumatic and hemorrhagic shock, and the increased vascular permeability associated with thermal injury, interleukin-2 therapy and cardiopulmonary bypass.

Reference

  • Davis AE 3rd. et al. (2004) Biological effects of C1 inhibitor. Drug News Perspect. 17(7): 439-46.
  • Cicardi M, et al. (2005) C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol. 27(3): 286-98.
  • Wouters D, et al. (2008) C1 inhibitor: just a serine protease inhibitor? New and old considerations on therapeutic applications of C1 inhibitor. Expert Opin Biol Ther. 8(8): 1225-40.
  • Cugno M, et al. (2009) C1-inhibitor deficiency and angioedema: molecular mechanisms and clinical progress. Trends Mol Med. 15(2): 69-78.