Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid(NM_021950.3)

Product Information

NCBI RefSeq: NM_021950.3

RefSeq ORF Size: 894

cDNA Description: Full length Clone DNA of Homo sapiens membrane-spanning 4-domains, subfamily A, member 1.

Gene Synonym: B1,Bp35,CD20,CVID5,LEU-16,MS4A1,MS4A2,S7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD20/MS4A1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid HG11007-UTLN pLV-untagged 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11007-CFLN pLV-C-FLAG 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11007-CHLN pLV-C-His 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11007-CMLN pLV-C-Myc 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11007-CYLN pLV-C-HA 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11007-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11007-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11007-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11007-NHLN pLV-SP-N-His 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11007-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD20/MS4A1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11007-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.