Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid(NM_001128148.1)

Product Information

NCBI RefSeq: NM_001128148.1

RefSeq ORF Size: 2283

cDNA Description: Full length Clone DNA of Homo sapiens transferrin receptor (p90, CD71).

Gene Synonym: CD71,p90,T9,TFR,TFR1,TR,TRFR

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TFRC/CD71 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid HG11020-UTLN pLV-untagged 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11020-CFLN pLV-C-FLAG 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11020-CHLN pLV-C-His 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11020-CMLN pLV-C-Myc 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11020-CYLN pLV-C-HA 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11020-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11020-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11020-NFLN pLV-SP-N-Flag 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11020-NHLN pLV-SP-N-His 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11020-NMLN pLV-SP-N-Myc 2-3 weeks
Human TFRC/CD71 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11020-NYLN pLV-SP-N-HA 2-3 weeks

Background

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

Reference

  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.