Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD24 Gene Lentiviral ORF cDNA expression plasmid(NM_013230.2)

Product Information

NCBI RefSeq: NM_013230.2

RefSeq ORF Size: 243

cDNA Description: Full length Clone DNA of Homo sapiens CD24 molecule.

Gene Synonym: CD24A,FLJ22950,FLJ43543,MGC75043

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD24 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD24 Gene Lentiviral ORF cDNA expression plasmid HG11030-UTLN pLV-untagged 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11030-CFLN pLV-C-FLAG 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11030-CHLN pLV-C-His 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11030-CMLN pLV-C-Myc 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11030-CYLN pLV-C-HA 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11030-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11030-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11030-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11030-NHLN pLV-SP-N-His 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11030-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD24 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11030-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 24, also known as signal transducer CD24 or heat stable antigen CD24 (HSA), is a mucin-type glycosylphosphatidylinositol-linked glycoprotein expressed on the surface of B-cells, differentiating neuroblasts and many tumors. It is involved in molecular adhesion and metastatic tumor spread and serve as a normal receptor for P-selectin. The CD24 / P-selectin pathway could be important in dissimenating of tumor cells by facilitating the interaction with platelet and endothelial cells. It has also been considered as a tumor marker. High rate of CD24 expressions have been found in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Kristiansen G, et al. (2003) Tumour biological aspects of CD24, a mucin-like adhesion molecule. Journal of molecular histology. 35 (3): 255-62.