Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid(NM_002506.2)

Product Information

NCBI RefSeq: NM_002506.2

RefSeq ORF Size: 726

cDNA Description: Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian).

Gene Synonym: Beta-NGF,HSAN5,NGFB

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human NGF/NGFB/beta-NGF Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid HG11050-UTLN pLV-untagged 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11050-CFLN pLV-C-FLAG 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11050-CHLN pLV-C-His 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11050-CMLN pLV-C-Myc 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11050-CYLN pLV-C-HA 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11050-ACGLN pLV-C-GFPSpark 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11050-ACRLN pLV-C-OFPSpark 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11050-NFLN pLV-SP-N-Flag 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11050-NHLN pLV-SP-N-His 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11050-NMLN pLV-SP-N-Myc 2-3 weeks
Human NGF/NGFB/beta-NGF Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11050-NYLN pLV-SP-N-HA 2-3 weeks

Background

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

Reference

  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.