Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid(AF043724.1)

Product Information

NCBI RefSeq: AF043724.1

RefSeq ORF Size: 1080

cDNA Description: Full length Clone DNA of Homo sapiens hepatitis A virus cellular receptor 1.

Gene Synonym: CD365,HAVCR,HAVCR-1,KIM-1,KIM1,TIM,TIM-1,TIM1,TIMD-1,TIMD1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TIM-1/KIM-1/HACVR Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid HG11051-UTLN pLV-untagged 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11051-CFLN pLV-C-FLAG 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11051-CHLN pLV-C-His 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11051-CMLN pLV-C-Myc 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11051-CYLN pLV-C-HA 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11051-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11051-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11051-NFLN pLV-SP-N-Flag 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11051-NHLN pLV-SP-N-His 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11051-NMLN pLV-SP-N-Myc 2-3 weeks
Human TIM-1/KIM-1/HACVR Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11051-NYLN pLV-SP-N-HA 2-3 weeks

Background

Human HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

Reference

  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.