Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid(NM_001171626.1)

Product Information

NCBI RefSeq: NM_001171626.1

RefSeq ORF Size: 576

cDNA Description: Full length Clone DNA of Homo sapiens vascular endothelial growth factor A transcript variant 4.

Gene Synonym: MVCD1,VEGF,VEGF165,VPF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid HG11066-UTLN pLV-untagged 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11066-CFLN pLV-C-FLAG 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11066-CHLN pLV-C-His 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11066-CMLN pLV-C-Myc 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11066-CYLN pLV-C-HA 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11066-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11066-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11066-NFLN pLV-SP-N-Flag 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11066-NHLN pLV-SP-N-His 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11066-NMLN pLV-SP-N-Myc 2-3 weeks
Human VEGF/VEGFA/VEGF165 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11066-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.