Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid(NM_004363.2)

Product Information

NCBI RefSeq: NM_004363.2

RefSeq ORF Size: 2094

cDNA Description: Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5.

Gene Synonym: CD66e,CEA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CEACAM5/CEA/CD66e Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid HG11077-UTLN pLV-untagged 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11077-CFLN pLV-C-FLAG 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11077-CHLN pLV-C-His 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11077-CMLN pLV-C-Myc 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11077-CYLN pLV-C-HA 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11077-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11077-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11077-NFLN pLV-SP-N-Flag 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11077-NHLN pLV-SP-N-His 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11077-NMLN pLV-SP-N-Myc 2-3 weeks
Human CEACAM5/CEA/CD66e Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11077-NYLN pLV-SP-N-HA 2-3 weeks

Background

CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 180 kDa comprising 60% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.
  • Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.
  • Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.