Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_000208.2)

Product Information

NCBI RefSeq: NM_000208.2

RefSeq ORF Size: 4149

cDNA Description: Full length Clone DNA of Homo sapiens insulin receptor transcript variant 1.

Gene Synonym: CD220,HHF5,Insulin Receptor

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG11081-UTLN pLV-untagged 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11081-CFLN pLV-C-FLAG 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11081-CHLN pLV-C-His 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11081-CMLN pLV-C-Myc 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11081-CYLN pLV-C-HA 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11081-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11081-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11081-NFLN pLV-SP-N-Flag 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11081-NHLN pLV-SP-N-His 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11081-NMLN pLV-SP-N-Myc 2-3 weeks
Human Insulin Receptor/INSR/CD220 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11081-NYLN pLV-SP-N-HA 2-3 weeks

Background

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Reference

  • Ebina Y., et al.,(1985), The human insulin receptor cDNA: the structural basis for hormone-activated transmembrane signalling. Cell 40:747-758.
  • Ullrich A., et al., (1985), Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes.Nature 313:756-761.
  • Grimwood J., et al.,(2004), The DNA sequence and biology of human chromosome 19.Nature 428:529-535.