Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid(NM_001038633.2)

Product Information

NCBI RefSeq: NM_001038633.2

RefSeq ORF Size: 792

cDNA Description: Full length Clone DNA of Homo sapiens R-spondin homolog (Xenopus laevis).

Gene Synonym: CRISTIN3,R-Spondin 1,RSPO

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human R-Spondin 1/RSPO1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid HG11083-UTLN pLV-untagged 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11083-CFLN pLV-C-FLAG 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11083-CHLN pLV-C-His 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11083-CMLN pLV-C-Myc 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11083-CYLN pLV-C-HA 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11083-ACGLN pLV-C-GFPSpark 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11083-ACRLN pLV-C-OFPSpark 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11083-NFLN pLV-SP-N-Flag 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11083-NHLN pLV-SP-N-His 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11083-NMLN pLV-SP-N-Myc 2-3 weeks
Human R-Spondin 1/RSPO1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11083-NYLN pLV-SP-N-HA 2-3 weeks

Background

RSPO1 gene is a member of the R-spondin family. It encodes RSPO1 which is known as a secreted activator protein with two cystein-rich, furin-like domains and one thrombospondin type 1 domain. In mice, RSPO1 induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. This protein is an activator of the beta-catenin signaling cascade, leading to TCF-dependent gene activation. RSPO1 acts both in the canonical Wnt/beta-catenin-dependent pathway and in non-canonical Wnt signaling pathway, probably by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. It also acts as a ligand for frizzled FZD8 and LRP6.

Reference

  • Kamata T, et al. (2004) R-spondin, a novel gene with thrombospondin type 1 domain, was expressed in the dorsal neural tube and affected in Wnts mutants. Biochim Biophys Acta. 1676(1):51-62.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.