Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_004355.2)

Product Information

NCBI RefSeq: NM_004355.2

RefSeq ORF Size: 699

cDNA Description: Full length Clone DNA of Homo sapiens CD74 molecule, major histocompatibility complex, class II invariant chain, transcript variant 2.

Gene Synonym: DHLAG,HLADG,Ia-GAMMA,II

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD74 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG11091-UTLN pLV-untagged 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11091-CFLN pLV-C-FLAG 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11091-CHLN pLV-C-His 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11091-CMLN pLV-C-Myc 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11091-CYLN pLV-C-HA 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11091-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11091-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11091-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11091-NHLN pLV-SP-N-His 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11091-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD74 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11091-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.