Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PEDF Gene Lentiviral ORF cDNA expression plasmid(NM_002615.4)

Product Information

NCBI RefSeq: NM_002615.4

RefSeq ORF Size: 1257

cDNA Description: Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1.

Gene Synonym: EPC-1,OI12,OI6,PEDF,PIG35

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PEDF Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PEDF Gene Lentiviral ORF cDNA expression plasmid HG11104-UTLN pLV-untagged 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11104-CFLN pLV-C-FLAG 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11104-CHLN pLV-C-His 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11104-CMLN pLV-C-Myc 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11104-CYLN pLV-C-HA 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11104-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11104-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11104-NFLN pLV-SP-N-Flag 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11104-NHLN pLV-SP-N-His 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11104-NMLN pLV-SP-N-Myc 2-3 weeks
Human PEDF Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11104-NYLN pLV-SP-N-HA 2-3 weeks

Background

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

Reference

  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.