Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_005214.3)

Product Information

NCBI RefSeq: NM_005214.3

RefSeq ORF Size: 672

cDNA Description: Full length Clone DNA of Homo sapiens cytotoxic T-lymphocyte-associated protein 4, transcript variant 1.

Gene Synonym: ALPS5,CD,CD152,CELIAC3,CTLA-4,GRD4,GSE,IDDM12

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CTLA-4/CD152 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG11159-UTLN pLV-untagged 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11159-CFLN pLV-C-FLAG 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11159-CHLN pLV-C-His 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11159-CMLN pLV-C-Myc 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11159-CYLN pLV-C-HA 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11159-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11159-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11159-NFLN pLV-SP-N-Flag 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11159-NHLN pLV-SP-N-His 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11159-NMLN pLV-SP-N-Myc 2-3 weeks
Human CTLA-4/CD152 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11159-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   CTLA4 / CD152 Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.