Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001024736.1)

Product Information

NCBI RefSeq: NM_001024736.1

RefSeq ORF Size: 1605

cDNA Description: Full length Clone DNA of Homo sapiens CD276 molecule transcript variant 1.

Gene Synonym: 4Ig-B7-H3,B7-H3,B7H3,B7RP-2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human B7-H3/CD276 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG11188-UTLN pLV-untagged 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11188-CFLN pLV-C-FLAG 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11188-CHLN pLV-C-His 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11188-CMLN pLV-C-Myc 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11188-CYLN pLV-C-HA 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11188-ACGLN pLV-C-GFPSpark 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11188-ACRLN pLV-C-OFPSpark 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11188-NFLN pLV-SP-N-Flag 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11188-NHLN pLV-SP-N-His 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11188-NMLN pLV-SP-N-Myc 2-3 weeks
Human B7-H3/CD276 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11188-NYLN pLV-SP-N-HA 2-3 weeks

Background

B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.