Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid(NM_000073.2)

Product Information

NCBI RefSeq: NM_000073.2

RefSeq ORF Size: 549

cDNA Description: Full length Clone DNA of Homo sapiens CD3g molecule, gamma (CD3-TCR complex).

Gene Synonym: CD3-GAMMA,IMD17,T3G

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD3g/CD3 gamma Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid HG11251-UTLN pLV-untagged 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11251-CFLN pLV-C-FLAG 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11251-CHLN pLV-C-His 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11251-CMLN pLV-C-Myc 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11251-CYLN pLV-C-HA 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11251-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11251-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11251-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11251-NHLN pLV-SP-N-His 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11251-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD3g/CD3 gamma Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11251-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.