Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human GPA33 Gene Lentiviral ORF cDNA expression plasmid(NM_005814.1)

Product Information

NCBI RefSeq: NM_005814.1

RefSeq ORF Size: 960

cDNA Description: Full length Clone DNA of Homo sapiens glycoprotein A33 (transmembrane).

Gene Synonym: A33

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human GPA33 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid HG11277-UTLN pLV-untagged 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11277-CFLN pLV-C-FLAG 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11277-CHLN pLV-C-His 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11277-CMLN pLV-C-Myc 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11277-CYLN pLV-C-HA 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11277-ACGLN pLV-C-GFPSpark 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11277-ACRLN pLV-C-OFPSpark 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11277-NFLN pLV-SP-N-Flag 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11277-NHLN pLV-SP-N-His 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11277-NMLN pLV-SP-N-Myc 2-3 weeks
Human GPA33 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11277-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9.