Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid(NM_001831.2)

Product Information

NCBI RefSeq: NM_001831.2

RefSeq ORF Size: 1506

cDNA Description: Full length Clone DNA of Homo sapiens clusterin.

Gene Synonym: AAG4,APO-J,APOJ,CLI,CLU1,CLU2,KUB1,NA1/NA2,SGP-2,SGP2,SP-40,TRPM-2,TRPM2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Clusterin/Apolipoprotein J/Apo-J Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid HG11297-UTLN pLV-untagged 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11297-CFLN pLV-C-FLAG 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11297-CHLN pLV-C-His 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11297-CMLN pLV-C-Myc 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11297-CYLN pLV-C-HA 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11297-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11297-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11297-NFLN pLV-SP-N-Flag 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11297-NHLN pLV-SP-N-His 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11297-NMLN pLV-SP-N-Myc 2-3 weeks
Human Clusterin/Apolipoprotein J/Apo-J Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11297-NYLN pLV-SP-N-HA 2-3 weeks

Background

Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

Reference

  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.