Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid(NM_001006946.1)

Product Information

NCBI RefSeq: NM_001006946.1

RefSeq ORF Size: 933

cDNA Description: Full length Clone DNA of Homo sapiens syndecan 11.

Gene Synonym: CD138,SDC,SYND1,syndecan,Syndecan-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Syndecan-1/CD138/SDC1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid HG11429-UTLN pLV-untagged 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11429-CFLN pLV-C-FLAG 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11429-CHLN pLV-C-His 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11429-CMLN pLV-C-Myc 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11429-CYLN pLV-C-HA 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11429-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11429-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11429-NFLN pLV-SP-N-Flag 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11429-NHLN pLV-SP-N-His 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11429-NMLN pLV-SP-N-Myc 2-3 weeks
Human Syndecan-1/CD138/SDC1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11429-NYLN pLV-SP-N-HA 2-3 weeks

Background

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

Reference

  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.