Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid(NM_006139.2)

Product Information

NCBI RefSeq: NM_006139.2

RefSeq ORF Size: 663

cDNA Description: Full length Clone DNA of Homo sapiens CD28 molecule.

Gene Synonym: Tp44

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD28/TP44 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid HG11524-UTLN pLV-untagged 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11524-CFLN pLV-C-FLAG 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11524-CHLN pLV-C-His 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11524-CMLN pLV-C-Myc 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11524-CYLN pLV-C-HA 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11524-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11524-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11524-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11524-NHLN pLV-SP-N-His 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11524-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD28/TP44 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11524-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.