Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid(NM_052938.4)

Product Information

NCBI RefSeq: NM_052938.4

RefSeq ORF Size: 1290

cDNA Description: Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) receptor 7.

Gene Synonym: CD307a,FCRH1,IFGP1,IRTA5

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FCRL1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid HG11536-UTLN pLV-untagged 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11536-CFLN pLV-C-FLAG 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11536-CHLN pLV-C-His 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11536-CMLN pLV-C-Myc 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11536-CYLN pLV-C-HA 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11536-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11536-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11536-NFLN pLV-SP-N-Flag 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11536-NHLN pLV-SP-N-His 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11536-NMLN pLV-SP-N-Myc 2-3 weeks
Human FCRL1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11536-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I  membrane protein which contains three Ig-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.

Reference

  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.