Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid(NM_001040022.1)

Product Information

NCBI RefSeq: NM_001040022.1

RefSeq ORF Size: 1512

cDNA Description: Full length Clone DNA of Homo sapiens signal-regulatory protein alpha.

Gene Synonym: BIT,CD172A,MFR,MYD-1,P84,PTPNS1,SHPS1,SIRP,SIRP alpha

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human SIRPA/SIRP alpha/CD172a Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid HG11612-UTLN pLV-untagged 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11612-CFLN pLV-C-FLAG 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11612-CHLN pLV-C-His 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11612-CMLN pLV-C-Myc 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11612-CYLN pLV-C-HA 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11612-ACGLN pLV-C-GFPSpark 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11612-ACRLN pLV-C-OFPSpark 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11612-NFLN pLV-SP-N-Flag 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11612-NHLN pLV-SP-N-His 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11612-NMLN pLV-SP-N-Myc 2-3 weeks
Human SIRPA/SIRP alpha/CD172a Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11612-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.