Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human B Raf Gene Lentiviral ORF cDNA expression plasmid(NM_004333.4)

Product Information

NCBI RefSeq: NM_004333.4

RefSeq ORF Size: 2301

cDNA Description: Full length Clone DNA of Homo sapiens v-raf murine sarcoma viral oncogene homolog B1.

Gene Synonym: B-RAF1,BRAF1,NS7,RAFB1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human B Raf Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human B Raf Gene Lentiviral ORF cDNA expression plasmid HG11632-UTLN pLV-untagged 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11632-CFLN pLV-C-FLAG 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11632-CHLN pLV-C-His 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11632-CMLN pLV-C-Myc 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11632-CYLN pLV-C-HA 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11632-ACGLN pLV-C-GFPSpark 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11632-ACRLN pLV-C-OFPSpark 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11632-NFLN pLV-SP-N-Flag 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11632-NHLN pLV-SP-N-His 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11632-NMLN pLV-SP-N-Myc 2-3 weeks
Human B Raf Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11632-NYLN pLV-SP-N-HA 2-3 weeks

Background

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.