Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid

Product Information

RefSeq ORF Size: 735

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 11.

Gene Synonym: CD254,hRANKL2,ODF,OPGL,OPTB2,RANKL,sOdf,TRANCE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human RANKL/OPGL/TNFSF11/CD254 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid HG11682-UTLN pLV-untagged 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11682-CFLN pLV-C-FLAG 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11682-CHLN pLV-C-His 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11682-CMLN pLV-C-Myc 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11682-CYLN pLV-C-HA 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11682-ACGLN pLV-C-GFPSpark 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11682-ACRLN pLV-C-OFPSpark 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11682-NFLN pLV-SP-N-Flag 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11682-NHLN pLV-SP-N-His 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11682-NMLN pLV-SP-N-Myc 2-3 weeks
Human RANKL/OPGL/TNFSF11/CD254 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11682-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.