Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid(BC070256)

Product Information

NCBI RefSeq: BC070256

RefSeq ORF Size: 501

cDNA Description: Full length Clone DNA of Homo sapiens interferon, gamma.

Gene Synonym: IFG,IFI,IFN gamma,Interferon Gamma

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Interferon Gamma/IFN gamma/IFNG Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid HG11725-UTLN pLV-untagged 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11725-CFLN pLV-C-FLAG 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11725-CHLN pLV-C-His 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11725-CMLN pLV-C-Myc 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11725-CYLN pLV-C-HA 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11725-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11725-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11725-NFLN pLV-SP-N-Flag 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11725-NHLN pLV-SP-N-His 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11725-NMLN pLV-SP-N-Myc 2-3 weeks
Human Interferon Gamma/IFN gamma/IFNG Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11725-NYLN pLV-SP-N-HA 2-3 weeks

Background

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.