Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid(BC067514)

Product Information

NCBI RefSeq: BC067514

RefSeq ORF Size: 462

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 4.

Gene Synonym: BCGF-1,BCGF1,BSF-1,BSF1,IL-4,Interleukin-4

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL4/IL-4/Interleukin-4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid HG11846-UTLN pLV-untagged 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11846-CFLN pLV-C-FLAG 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11846-CHLN pLV-C-His 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11846-CMLN pLV-C-Myc 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11846-CYLN pLV-C-HA 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11846-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11846-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11846-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11846-NHLN pLV-SP-N-His 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11846-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL4/IL-4/Interleukin-4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11846-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.