Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid(BC066257)

Product Information

NCBI RefSeq: BC066257

RefSeq ORF Size: 462

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 2.

Gene Synonym: IL-2,Interleukin-2,lymphokine,TCGF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL2/IL-2/Interleukin-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid HG11848-UTLN pLV-untagged 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11848-CFLN pLV-C-FLAG 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11848-CHLN pLV-C-His 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11848-CMLN pLV-C-Myc 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11848-CYLN pLV-C-HA 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11848-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11848-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11848-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11848-NHLN pLV-SP-N-His 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11848-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL2/IL-2/Interleukin-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11848-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.