Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid(BC006338)

Product Information

NCBI RefSeq: BC006338

RefSeq ORF Size: 1671

cDNA Description: Full length Clone DNA of Homo sapiens CD19 molecule.

Gene Synonym: B4,CVID3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD19/B4/CVID3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid HG11880-UTLN pLV-untagged 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11880-CFLN pLV-C-FLAG 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11880-CHLN pLV-C-His 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11880-CMLN pLV-C-Myc 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11880-CYLN pLV-C-HA 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11880-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11880-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11880-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11880-NHLN pLV-SP-N-His 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11880-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD19/B4/CVID3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11880-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.