Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_020975.4)

Product Information

NCBI RefSeq: NM_020975.4

RefSeq ORF Size: 3345

cDNA Description: Full length Clone DNA of Homo sapiens ret proto-oncogene, transcript variant 2.

Gene Synonym: CDHF12,CDHR16,HSCR1,MEN2A,MEN2B,MTC1,PTC,RET-ELE1,RET51

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human RET transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG11997-UTLN pLV-untagged 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11997-CFLN pLV-C-FLAG 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11997-CHLN pLV-C-His 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11997-CMLN pLV-C-Myc 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11997-CYLN pLV-C-HA 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11997-ACGLN pLV-C-GFPSpark 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11997-ACRLN pLV-C-OFPSpark 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11997-NFLN pLV-SP-N-Flag 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11997-NHLN pLV-SP-N-His 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11997-NMLN pLV-SP-N-Myc 2-3 weeks
Human RET transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11997-NYLN pLV-SP-N-HA 2-3 weeks

Background

RET proto-oncogene, also known as RET, is a cell-surface molecule that transduce signals for cell growth and differentiation. It contains 1 cadherin domain and 1 protein kinase domain. RET proto-oncogene belongs to the protein kinase superfamily, tyr protein kinase family. RET proto-oncogene is involved in numerous cellular mechanisms including cell proliferation, neuronal navigation, cell migration, and cell differentiation upon binding with glial cell derived neurotrophic factor family ligands. It phosphorylates PTK2/FAK1 and regulates both cell death/survival balance and positional information. RET is required for the molecular mechanisms orchestration during intestine organogenesis; involved in the development of enteric nervous system and renal organogenesis during embryonic life; promotes the formation of Peyer's patch-like structures; modulates cell adhesion via its cleavage; involved in the development of the neural crest. RET proto-oncogene is active in the absence of ligand, triggering apoptosis. RET acts as a dependence receptor; in the presence of the ligand GDNF in somatotrophs (within pituitary), promotes survival and down regulates growth hormone (GH) production, but triggers apoptosis in absence of GDNF. It also regulates nociceptor survival and size; triggers the differentiation of rapidly adapting (RA) mechanoreceptors; mediated several diseases such as neuroendocrine cancers. Defects in RET may cause colorectal cancer, hirschsprung disease type 1, medullary thyroid carcinoma, multiple neoplasia type 2B, susceptibility to pheochromocytoma, multiple neoplasia type 2A, thyroid papillary carcinoma and congenital central hypoventilation syndrome.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Ciampi R, et al. (2012) Chromosome 10 and RET gene copy number alterations in hereditary and sporadic Medullary Thyroid Carcinoma. Mol Cell Endocrinol. 348(1):176-82.
  • Garcia-Lavandeira M, et al. (2012) Craniopharyngiomas express embryonic stem cell markers (SOX2, OCT4, KLF4, and SOX9) as pituitary stem cells but do not coexpress RET/GFRA3 receptors. J Clin Endocrinol Metab. 97(1):E80-7.
  • Stine ZE, et al. (2011) Steroid hormone modulation of RET through two estrogen responsive enhancers in breast cancer. Hum Mol Genet. 20(19):3746-56.
  • Sharma BP, et al. (2011) RET gene mutations and polymorphisms in medullary thyroid carcinomas in Indian patients. J Biosci. 36(4):603-11.