Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid(NM_002190)

Product Information

NCBI RefSeq: NM_002190

RefSeq ORF Size: 468

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 17A.

Gene Synonym: CTLA-8,CTLA8,IL-17,IL-17A,IL17

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL17A/IL-17A/IL17 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid HG12047-UTLN pLV-untagged 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12047-CFLN pLV-C-FLAG 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12047-CHLN pLV-C-His 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12047-CMLN pLV-C-Myc 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12047-CYLN pLV-C-HA 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12047-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12047-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12047-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12047-NHLN pLV-SP-N-His 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12047-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL17A/IL-17A/IL17 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12047-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.