Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid(NM_002524)

Product Information

NCBI RefSeq: NM_002524

RefSeq ORF Size: 570

cDNA Description: Full length Clone DNA of Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog.

Gene Synonym: ALPS4,CMNS,N-ras,NCMS,NRAS1,NS6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human NRAS / N-Ras Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid HG12073-UTLN pLV-untagged 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12073-CFLN pLV-C-FLAG 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12073-CHLN pLV-C-His 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12073-CMLN pLV-C-Myc 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12073-CYLN pLV-C-HA 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12073-ACGLN pLV-C-GFPSpark 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12073-ACRLN pLV-C-OFPSpark 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12073-NFLN pLV-SP-N-Flag 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12073-NHLN pLV-SP-N-His 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12073-NMLN pLV-SP-N-Myc 2-3 weeks
Human NRAS / N-Ras Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12073-NYLN pLV-SP-N-HA 2-3 weeks

Background

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.