Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid(BC027881)

Product Information

NCBI RefSeq: BC027881

RefSeq ORF Size: 1830

cDNA Description: Full length Clone DNA of Homo sapiens alpha-fetoprotein.

Gene Synonym: AFPD,Alpha-fetoprotein,FETA,HPAFP

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Alpha-fetoprotein/AFP Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid HG12177-UTLN pLV-untagged 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12177-CFLN pLV-C-FLAG 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12177-CHLN pLV-C-His 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12177-CMLN pLV-C-Myc 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12177-CYLN pLV-C-HA 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12177-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12177-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12177-NFLN pLV-SP-N-Flag 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12177-NHLN pLV-SP-N-His 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12177-NMLN pLV-SP-N-Myc 2-3 weeks
Human Alpha-fetoprotein/AFP Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12177-NYLN pLV-SP-N-HA 2-3 weeks

Background

Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.