Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid(BC012506)

Product Information

NCBI RefSeq: BC012506

RefSeq ORF Size: 600

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 11.

Gene Synonym: AGIF,IL-11

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL-11 / interleukin 11 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid HG12225-UTLN pLV-untagged 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12225-CFLN pLV-C-FLAG 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12225-CHLN pLV-C-His 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12225-CMLN pLV-C-Myc 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12225-CYLN pLV-C-HA 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12225-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12225-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12225-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12225-NHLN pLV-SP-N-His 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12225-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL-11 / interleukin 11 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12225-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

Reference

  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.